View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1531_1D_low_32 (Length: 268)
Name: NF1531_1D_low_32
Description: NF1531_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1531_1D_low_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 26 - 264
Target Start/End: Complemental strand, 49084099 - 49083861
Alignment:
| Q |
26 |
tgtgaaggtttattcacctaaagagatagattttgccacaagggatgcaagttttccacatttcaggttttgatagcgtgacaaccgataaatctgaatt |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49084099 |
tgtgaaggtttattcacctaaagagatagattttgccacaagggatgcaagttttccacatttcaggttttgatagcgtgacaaccgataaatctgaatt |
49084000 |
T |
|
| Q |
126 |
ccacaatgaagatctctctggtttatgagaatgattcataagcaaatcagtgagatattcatcaagattttggtctctggatgttgctcaaaagacataa |
225 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49083999 |
ccacaatgaagatctctttggtttatgagaatgattcataagcaaatcagtgagatattcatcaagattttggtctctggatgttgctcaaaagacataa |
49083900 |
T |
|
| Q |
226 |
tagggggaagtagttgagtgatgcatctcaactgaaatt |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49083899 |
tagggggaagtagttgagtgatgcatctcaactgaaatt |
49083861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 191 - 240
Target Start/End: Original strand, 20402340 - 20402389
Alignment:
| Q |
191 |
gattttggtctctggatgttgctcaaaagacataatagggggaagtagtt |
240 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||| ||||| |||| |
|
|
| T |
20402340 |
gattttgttctctggatcatgctcaaaagacataataggaggaagcagtt |
20402389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 189 - 257
Target Start/End: Complemental strand, 32116942 - 32116874
Alignment:
| Q |
189 |
aagattttggtctctggatgttgctcaaaagacataatagggggaagtagttgagtgatgcatctcaac |
257 |
Q |
| |
|
|||||||||||| || ||||||| ||||||||||||||||| ||||| | |||| | ||||||||||| |
|
|
| T |
32116942 |
aagattttggtcactagatgttggtcaaaagacataataggcggaagcacttgaccggtgcatctcaac |
32116874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University