View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1531_1D_low_42 (Length: 248)
Name: NF1531_1D_low_42
Description: NF1531_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1531_1D_low_42 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 121
Target Start/End: Original strand, 11834007 - 11834127
Alignment:
| Q |
1 |
aaaggccaatcgtttttatttaggaatcaaaatactaaacatcataaagtaagcaaaatatgctttacaattacaattgattgattctctaatctaagct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11834007 |
aaaggccaatcgtttttatttaggaatcaaaatactaaacatcataaagtaagcaaaatatgctttacaattacaattgattgattctctaatctaagct |
11834106 |
T |
 |
| Q |
101 |
tttcttggaagaatgggaata |
121 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
11834107 |
tttcttggaagaatgggaata |
11834127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 213 - 248
Target Start/End: Complemental strand, 11827777 - 11827742
Alignment:
| Q |
213 |
aagggctactgggatgaagttcgataaagggttggg |
248 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11827777 |
aagggctactgggatgaagtccgataaagggttggg |
11827742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University