View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1531_1D_low_46 (Length: 230)
Name: NF1531_1D_low_46
Description: NF1531_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1531_1D_low_46 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 29 - 195
Target Start/End: Original strand, 14116676 - 14116842
Alignment:
| Q |
29 |
ctagtcgctctgcctgagttaccgtcgtgtttttaaatataatatatgttgtacatttttctgtgacgtctttataacagtgtgtgaaattcgtaatacc |
128 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14116676 |
ctagtcgctctgcctcagttaccgtcgcgtttttaaatataatatatgttgtacatttttctgtgacgtctttataacagtgtgtgaaattcgtaatacc |
14116775 |
T |
|
| Q |
129 |
atagacaaaacacatacgacaccccattctcttaaaaagaaaaagtgattatgatcgatgctcatag |
195 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14116776 |
atagacaaaacacatacgacaccccattgtcttaaaaagaaaaagtgattatgatcgattctcatag |
14116842 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University