View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1531_1D_low_53 (Length: 214)
Name: NF1531_1D_low_53
Description: NF1531_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1531_1D_low_53 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 20 - 210
Target Start/End: Original strand, 32261308 - 32261499
Alignment:
| Q |
20 |
catcgtcctcgagtcttaagttcatcaagcatatttgatgaagaaatgagaacaatccaaaacactccaagaaattcagagtttcgcattgttacttgtt |
119 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32261308 |
catcgtcctcgagtattaagttcatcaagcatatttgatgaagaaatgagaacaatccaaaacactccaagaaattcagagtttcgcattgttacttgtt |
32261407 |
T |
 |
| Q |
120 |
tacatagtgaaggaaacgttcgtggcatgactgccctagtggaaatttgcaacccaattcaagaaagtccc-tatgtgtctttgtgattcat |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32261408 |
tacatagtgaaggaaacgttcgtggcatgactgccctagtggaaatttgcaacccaattcaagaaagtcccttatgtgtctttgtgattcat |
32261499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University