View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15320_low_16 (Length: 264)
Name: NF15320_low_16
Description: NF15320
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15320_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 21 - 244
Target Start/End: Complemental strand, 50658883 - 50658660
Alignment:
| Q |
21 |
tagagggtcaatgtttaataaaaacagcaagccaataactaatatttctccaccatatgttggtttctttgatcccgcgtttttgaaagccgatgcatgg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
50658883 |
tagagggtcaatgtttaataaaaacagcaagccaataactaatatttctccaccttatgttggtttctttgatcctgcgtttttgaaagccgatgcatgg |
50658784 |
T |
 |
| Q |
121 |
catccaaagaaaccaagcggatggctgtgactttggtgtttgaagagatggtggaggttgcttgggttactcatccagcaaataacttctataggccaca |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50658783 |
catccaaagaaaccaagcggatggctgtgactttggtgtttgaagagatggtggaggttgcttgggttactcatccagcaaataacttctataggccaca |
50658684 |
T |
 |
| Q |
221 |
aagtgtgtccagactggatgtgtt |
244 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
50658683 |
aagtgtgtccagactggatgtgtt |
50658660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University