View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15321_low_6 (Length: 271)
Name: NF15321_low_6
Description: NF15321
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15321_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 2 - 206
Target Start/End: Complemental strand, 52165278 - 52165074
Alignment:
| Q |
2 |
tgaatgggacgtatttggcagtgaagttgttgacggtggcagggtgacggcgggcgatgtctttgatgttgtcgatggcgagatccggtgatggagagtg |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
52165278 |
tgaatgggacgtatttggcagtgaagttgttggaggtggcagggtgacggcgggcgatgtctttgatgttgtcggtggcgagatccggtgatggagagtg |
52165179 |
T |
|
| Q |
102 |
gttgttggtggtggcggtggcgacggtgagtgtgcggttatgtgtgttcggtttatgagcgttaaaaacgagggtggagaatgaaggatgaaacagagaa |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52165178 |
gttgttggtggtggcggtggcgacggtgagtgtgcggttatgtgtattcggtttaggagcgttaaaaacgagggtggagaatgaaggatgaaacagagaa |
52165079 |
T |
|
| Q |
202 |
gacac |
206 |
Q |
| |
|
||||| |
|
|
| T |
52165078 |
gacac |
52165074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 117 - 205
Target Start/End: Original strand, 19437849 - 19437934
Alignment:
| Q |
117 |
ggtggcgacggtgagtgtgcggttatgtgtgttcggtttatgagcgttaaaaacgagggtggagaatgaaggatgaaacagagaagaca |
205 |
Q |
| |
|
||||||||| || |||||||||||||||| | ||||| | |||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
19437849 |
ggtggcgacagtaagtgtgcggttatgtgag---ggttttggggcgttaaaaagaagggtggagaatgaaggatgaaacagagaagaca |
19437934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 117 - 205
Target Start/End: Original strand, 19573998 - 19574083
Alignment:
| Q |
117 |
ggtggcgacggtgagtgtgcggttatgtgtgttcggtttatgagcgttaaaaacgagggtggagaatgaaggatgaaacagagaagaca |
205 |
Q |
| |
|
||||||||| || |||||||||||||||| | ||||| | |||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
19573998 |
ggtggcgacagtaagtgtgcggttatgtgag---ggttttggggcgttaaaaagaagggtggagaatgaaggatgaaacagagaagaca |
19574083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 15 - 75
Target Start/End: Original strand, 19437775 - 19437835
Alignment:
| Q |
15 |
tttggcagtgaagttgttgacggtggcagggtgacggcgggcgatgtctttgatgttgtcg |
75 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||| || ||||||||||||||||| |
|
|
| T |
19437775 |
tttggcagtgaagttgttggtggtgaaagggtgacggcgagcattgtctttgatgttgtcg |
19437835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 15 - 75
Target Start/End: Original strand, 19573924 - 19573984
Alignment:
| Q |
15 |
tttggcagtgaagttgttgacggtggcagggtgacggcgggcgatgtctttgatgttgtcg |
75 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||| || ||||||||||||||||| |
|
|
| T |
19573924 |
tttggcagtgaagttgttggtggtgaaagggtgacggcgagcattgtctttgatgttgtcg |
19573984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University