View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15322_high_33 (Length: 264)
Name: NF15322_high_33
Description: NF15322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15322_high_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 6e-80; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 19 - 235
Target Start/End: Original strand, 991753 - 991962
Alignment:
| Q |
19 |
aattaattgtcatatatga-tcgagttctgtttgtgcataattgtcggttgccatgtagtctcaattccagttgcattgtggtttcgacaacaacaaaaa |
117 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
991753 |
aattaattgtcatatatgaatcgagttctgtttgtgcatagttgtcggttgccatgtagtctcaattccagttgcattgtggtttcg---acaacaaaaa |
991849 |
T |
 |
| Q |
118 |
ccgccatgttatgactaaaatcgccgtagcagacctttattaatttaacaccctaatgatttttctattgagactaatcgcacgctggtcacaagcgcta |
217 |
Q |
| |
|
||| |||||||||||| |||||||||||||||||| || ||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
991850 |
ccgtcatgttatgact-aaatcgccgtagcagacc----ttgatttaacaccctaatgattgttctattgagactaatcgcacgatggtcacaagcgcta |
991944 |
T |
 |
| Q |
218 |
tggtaagacaccgacaaa |
235 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
991945 |
tggtaagacaccgacaaa |
991962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 40 - 158
Target Start/End: Original strand, 1012143 - 1012257
Alignment:
| Q |
40 |
gagttctgtttgtgcataattgtcggttgccatgtagtctcaattccagttgcattgtggtttcgacaacaacaaaaaccgccatgttatgactaaaatc |
139 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||| ||||||| ||||||||||||||||||| |||| |||||| ||| |||||||| |||| |
|
|
| T |
1012143 |
gagttatgtttgtgcataattgtcggttatgatgtagcctcaattgcagttgcattgtggtttcgtcaac----aaaaccatcattttatgactcaaata |
1012238 |
T |
 |
| Q |
140 |
gccgtagcagacctttatt |
158 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
1012239 |
gccgtagcagacctttatt |
1012257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 40 - 111
Target Start/End: Original strand, 1029454 - 1029525
Alignment:
| Q |
40 |
gagttctgtttgtgcataattgtcggttgccatgtagtctcaattccagttgcattgtggtttcgacaacaa |
111 |
Q |
| |
|
||||| |||||||| |||||||||||||| |||||| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
1029454 |
gagttatgtttgtgtgtaattgtcggttgcgatgtagcctcaattccagttgcattgtggtttcgtcaacaa |
1029525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 46 - 96
Target Start/End: Original strand, 1029404 - 1029454
Alignment:
| Q |
46 |
tgtttgtgcataattgtcggttgccatgtagtctcaattccagttgcattg |
96 |
Q |
| |
|
||||||||| ||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
1029404 |
tgtttgtgcgtaattatcggttgcgatgtagtctcaattccagttgcattg |
1029454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University