View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15322_high_45 (Length: 227)
Name: NF15322_high_45
Description: NF15322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15322_high_45 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 5 - 227
Target Start/End: Original strand, 52379834 - 52380054
Alignment:
| Q |
5 |
cagtaagagagttgttgtttgtttattatgagaaaagatggtgacttgaactagctcaatgtcttaatgtagagactttgggggttaaggagaaattgtg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52379834 |
cagtaagagagttgttgtttgtttattatgagaaaatatggtgacttgaactagctcaatgtcttaatgtagagactttgggggttaaggagaaattgtg |
52379933 |
T |
|
| Q |
105 |
gtactagttccttaaataagggagtgtcaagtgggggtgtttgcaagttggctattactttttacacgatattattccaatacttcaccatatacctcta |
204 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
52379934 |
gtactagttccttaaataagggattgtcaagtgggggtgtttgcaagttggctattactttttacacgatattattccaatacttcacc--atacctcta |
52380031 |
T |
|
| Q |
205 |
aatccaggggatattgcttatta |
227 |
Q |
| |
|
|||||| |||||||||||||||| |
|
|
| T |
52380032 |
aatccaagggatattgcttatta |
52380054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University