View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15322_high_47 (Length: 216)
Name: NF15322_high_47
Description: NF15322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15322_high_47 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 16 - 196
Target Start/End: Complemental strand, 46885216 - 46885036
Alignment:
| Q |
16 |
cataatacagatcttcttgattattcattgggtaataattatcagttgggatcgtttcacccataccacttccatgaccagtattgtcattaccatgatc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46885216 |
cataatacagatcttcttgattattcattgggtaataattatcagttgggatcgtttcacccataccacttccatgaccagtattgtcattaccatgatc |
46885117 |
T |
|
| Q |
116 |
atgagagattccatggtcatcactagtattagtattactatggagctctaatgtctcagagtctgaattttcattttcatt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46885116 |
atgagagattccatggtcatcactagtattagtattactatggagctctaatgtctcagagtctgaattttcattttcatt |
46885036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University