View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15322_low_50 (Length: 239)
Name: NF15322_low_50
Description: NF15322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15322_low_50 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 40831846 - 40831609
Alignment:
| Q |
1 |
ctgatgtaaacaggttaaaaatcaagcagtaaaattcatgggttctttgttaatttaataatctatcaccaacaataacactactagctaaactagatag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40831846 |
ctgatgtaaacaggttaaaaatcaagcagtaaaattcatgggttctttgttaatttaataatctatcaccaacaataacactactagctaaactagatag |
40831747 |
T |
 |
| Q |
101 |
ataagtaaaagaagg-nnnnnnntatgtgacacaaagctatagttgcaaaatgaatgaggtgagtgattgattggaaattggtcagtttatcatccccta |
199 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40831746 |
ataagtaaaagaaggaaaaaaaatatgtgacacaaagctatagttgtaaaatgaatgaggtgagtgattgattggaaattggtcattttatcatccccta |
40831647 |
T |
 |
| Q |
200 |
tttcttagaccatgcccagagagaatacatagccacca |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40831646 |
tttcttagaccatgcccagagagaatacatagccacca |
40831609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University