View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15322_low_51 (Length: 238)
Name: NF15322_low_51
Description: NF15322
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15322_low_51 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 3e-84; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 167
Target Start/End: Complemental strand, 51189319 - 51189151
Alignment:
| Q |
1 |
ctccaaccaaagaaaacctacctaaataatatgtattaaattcaaaatttataagaat--ttatttgtcctactaataccggtatcttatcaaaattccc |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51189319 |
ctccaaccaaagaaaacctacctaaataatatgtattaaattcaaaatttataagaatatttatttgtcctactaataccggtatcttatcaaaattccc |
51189220 |
T |
|
| Q |
99 |
tgtctgtgttacgtacgagtactattattatactatccttccttcctcttgcagaaaaacaattgaaga |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51189219 |
tgtctgtgttacgtacgagtactattattatactatccttccttcctcttgcagaaaaacaattgaaga |
51189151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 172 - 221
Target Start/End: Complemental strand, 51189117 - 51189068
Alignment:
| Q |
172 |
atcaattgcagccaactgtcactgttggacactataatctcagttgcaac |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51189117 |
atcaattgcagccaactgtcactgttggacactataatctcagttgcaac |
51189068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University