View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15323_low_5 (Length: 244)
Name: NF15323_low_5
Description: NF15323
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15323_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 12 - 193
Target Start/End: Complemental strand, 42113126 - 42112945
Alignment:
| Q |
12 |
gagatgaataagaaagttgttatgagaatgaaaagaaggcatagatagggtttaattatgggccggatgggacagcggggataagaggaaacactttgat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42113126 |
gagatgaataagaaagttgttatgagaatgaaaagaaggcatagatagggtttaattatgggccggatgggacagcggggataagaggaaacactttgat |
42113027 |
T |
|
| Q |
112 |
caatgattaaatgtgttttgtttctctgtctccccactactcccaaccggtgggagagaaacagctacgaaaaagatttggg |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42113026 |
caatgattaaatgtgttttgtttctctgtctccccactactcccaaccggtgggagagaaacagctgcgaaaaagatttggg |
42112945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University