View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15324_high_17 (Length: 397)
Name: NF15324_high_17
Description: NF15324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15324_high_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 306; Significance: 1e-172; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 18 - 390
Target Start/End: Complemental strand, 26777311 - 26776941
Alignment:
| Q |
18 |
tattttgcatgggaaatgtcataggacgcaagttcattgttacccctggcatatacttgtccaagaaactggtccaataccataagccatctatccggga |
117 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26777311 |
tattttgcatgggaaatgtcataggacccaagttcattggtacccctggcata--cttgtccaagaaactggtccaataccataagccatctgtccggga |
26777214 |
T |
|
| Q |
118 |
gtgcaattccgtcctcctataggttgcccgatcctatgagcagcataagctccaactccagaaggcggggttgcaacatacattccggcacgtggagctg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| ||||||||||||||||| ||||| ||| |
|
|
| T |
26777213 |
gtgcaattccgtcctcctataggttgcccgatcctatgagcagcataaactccgactccagaaggcggggtcacaacatacattccggcaggtggaactg |
26777114 |
T |
|
| Q |
218 |
gtggatcatttaaagttctggtaccagcagatggagcttgaggagtttgtgtggctgattttctggcagaatcgcttgcttgatcggtaattgctccatg |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| |||| ||||||||| |||||||||||||||| |
|
|
| T |
26777113 |
gtggatcatttaaagttctggtaccagcagatggagcttgaggagtttgtgtggctgattgtcttgcataatcacttgcttgaccggtaattgctccatg |
26777014 |
T |
|
| Q |
318 |
aggtgctgaaatgtctccattttcgacatatgtgacatcatgtctgctggatcgccttctttctttcttctct |
390 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26777013 |
aggtgctgaaatgtctccattttcgacatatgtgacatcatgtctgctggatcgccttctttctttcttctct |
26776941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 283 - 390
Target Start/End: Original strand, 26553800 - 26553907
Alignment:
| Q |
283 |
gcagaatcgcttgcttgatcggtaattgctccatgaggtgctgaaatgtctccattttcgacatatgtgacatcatgtctgctggatcgccttctttctt |
382 |
Q |
| |
|
||||||| |||||||||| ||||||||| ||| ||||||||||||||||||||||||| |||| | |||||||||||| ||||||||||||||||||||| |
|
|
| T |
26553800 |
gcagaattgcttgcttgaccggtaattggtccttgaggtgctgaaatgtctccatttttgacaaaggtgacatcatgtatgctggatcgccttctttctt |
26553899 |
T |
|
| Q |
383 |
tcttctct |
390 |
Q |
| |
|
|||||||| |
|
|
| T |
26553900 |
tcttctct |
26553907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 24 - 118
Target Start/End: Original strand, 26553534 - 26553626
Alignment:
| Q |
24 |
gcatgggaaatgtcataggacgcaagttcattgttacccctggcatatacttgtccaagaaactggtccaataccataagccatctatccgggag |
118 |
Q |
| |
|
|||||| | |||||||||||| || |||||||| ||||||||||||| || |||| |||||||||||||| ||||||| |||| | |||||||| |
|
|
| T |
26553534 |
gcatggcatatgtcataggacccaggttcattggtacccctggcata-ac-tgtctcagaaactggtccaagaccataatccatgtctccgggag |
26553626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 128 - 161
Target Start/End: Original strand, 26553666 - 26553699
Alignment:
| Q |
128 |
gtcctcctataggttgcccgatcctatgagcagc |
161 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
26553666 |
gtcctcctataggttgcccgatcctaggagcagc |
26553699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University