View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15324_high_25 (Length: 331)
Name: NF15324_high_25
Description: NF15324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15324_high_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 22 - 324
Target Start/End: Original strand, 41132897 - 41133199
Alignment:
| Q |
22 |
gtaccaatatcaccatatacaattcctatgctttgaaatgccaaactcaatgtcacgctccaacccacctgcatatcacatataattaatttgtcaagag |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41132897 |
gtaccaatatcaccatatacaattcctatgctttgaaatgccaaagtcaatgtcacgctccaacccacctgcatgtcacatataattaatttgtcaagag |
41132996 |
T |
 |
| Q |
122 |
gaaaatattaattcttacatacaatactatatatgaaatatatatgcatgaagaccttggaattgtggtttgcattcatagaaactcttccagcttctaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41132997 |
gaaaatattaattcttacatacaatactatatatgaaatatatatgcatgaagaccttggaattgtggtttgcattcatagaaactcttccagcttctaa |
41133096 |
T |
 |
| Q |
222 |
attgagggagtctacacgacgtagttttgcccatgacacctttcgatctttcagctttttctccgtaatctcctttgttgtttctgtctcatcctctctg |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
41133097 |
attgagggagtctacacgacgtagttttgcccatgacacctttcgatctttcagctttttctccgtaatctcctttgttgtttctgtctcatcctctatg |
41133196 |
T |
 |
| Q |
322 |
ctc |
324 |
Q |
| |
|
||| |
|
|
| T |
41133197 |
ctc |
41133199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University