View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15324_high_26 (Length: 328)
Name: NF15324_high_26
Description: NF15324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15324_high_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 71; Significance: 4e-32; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 227 - 297
Target Start/End: Complemental strand, 9658331 - 9658261
Alignment:
| Q |
227 |
cacgcaataatttatgcagggaatttaggtcccttgaagatggctctttgtcctaacggtttatgaatcca |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9658331 |
cacgcaataatttatgcagggaatttaggtcccttgaagatggctctttgtcctaacggtttatgaatcca |
9658261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University