View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15324_high_37 (Length: 284)
Name: NF15324_high_37
Description: NF15324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15324_high_37 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 12 - 271
Target Start/End: Complemental strand, 34609220 - 34608970
Alignment:
| Q |
12 |
ccgatctggaaaaacgtgacactgatctactcaacctctgcttcttcatcttgctaggcttgtcaccatgatcagcatcaatgctcgttgtttctggtga |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34609220 |
ccgatctggaaaaacgtgacactgatctactcaacctctgcttcttcatcttgctaggcttgtcaccatgatcagcatcaatgctcgttgtttctggtga |
34609121 |
T |
|
| Q |
112 |
tcgctctctttttctaccttgccttgatggtagttgttgggttaacgagtttttctttgtctccgttgaagcttcttgttgttcttgtgttgattcagta |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
34609120 |
tcgctctctttttctaccttgccttgatggtagttgttgggttaacgagtttttctttgtcaccgttgaagcttc---------ttgtgttgattcagta |
34609030 |
T |
|
| Q |
212 |
tccatggcgaaatcgtttggtggtgtttctccaatgctatgctgaaccattgttgttgtt |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34609029 |
tccatggcgaaatcgtttggtggtgtttctccaatgctatgctgaaccattgttgttgtt |
34608970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University