View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15324_high_49 (Length: 238)
Name: NF15324_high_49
Description: NF15324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15324_high_49 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 23 - 229
Target Start/End: Complemental strand, 917854 - 917650
Alignment:
| Q |
23 |
ttactattatttaaagtgataacaacatacaccaccaacacattatattttgccgttagagtttcacataatttgatgagatccatatgaattttaatca |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
917854 |
ttactattatttaaagtgataacaacatacaccacaaacaccttatattttgccgttagagtttcacataatttagtgagatccatatgaattttaatca |
917755 |
T |
 |
| Q |
123 |
atnnnnnnnnnnngtttttattttcccatgtgtccgagtatcaaacctaaatcttcaaggttgaagaacaaattttcaacaaaatgctttacttttctat |
222 |
Q |
| |
|
|| |||||||| ||||||| |||| |||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
917754 |
at--aaaaaaaatgtttttatcttcccatatgtctgagtatcaaacctaaatcatcaagattgaagaacaaattttcaacaaaatgctttacttttctat |
917657 |
T |
 |
| Q |
223 |
ttcttct |
229 |
Q |
| |
|
||||||| |
|
|
| T |
917656 |
ttcttct |
917650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University