View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15324_high_55 (Length: 208)
Name: NF15324_high_55
Description: NF15324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15324_high_55 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 59; Significance: 3e-25; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 12 - 74
Target Start/End: Original strand, 55260 - 55322
Alignment:
| Q |
12 |
catcatcaattatatttaatagaaattgtggtagtagtaaacacaaatgttatagaactattg |
74 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
55260 |
catcatcaattatatttaatagaaattgtggtagtagcaaacacaaatgttatagaactattg |
55322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University