View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15324_low_18 (Length: 421)
Name: NF15324_low_18
Description: NF15324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15324_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 91; Significance: 6e-44; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 239 - 374
Target Start/End: Complemental strand, 16905221 - 16905084
Alignment:
| Q |
239 |
tagtgttgaatgatgtcgaagagggcaggagttaggtgtagttggaggtgtatgttgtttgaatgggaggaagagttggttgtggagtgta--ttctttt |
336 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| | |||||||||| || |||| |
|
|
| T |
16905221 |
tagtgttgaatgatgtagaagagggcaggagttaggtgtagttggaggtgcatgttgtttgaatgtgaggaagagttgttcgtggagtgtattttttttt |
16905122 |
T |
 |
| Q |
337 |
gattgataatcttgtattgcatgaaacgcattggatag |
374 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
16905121 |
tattggtaatcttgtattgcatgaaacacattggatag |
16905084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 10 - 69
Target Start/End: Complemental strand, 16905319 - 16905260
Alignment:
| Q |
10 |
aaatgaaagagaattggctattaaataaaaaatcagataaaataattagttttaaattac |
69 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
16905319 |
aaatgaaagagaattggctattaaatgaaaaatcagataaaataattagttttaaattac |
16905260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 292 - 329
Target Start/End: Original strand, 447107 - 447144
Alignment:
| Q |
292 |
gttgtttgaatgggaggaagagttggttgtggagtgta |
329 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
447107 |
gttgtttgcatgggaggaagagttggtggtggagtgta |
447144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University