View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15324_low_19 (Length: 416)
Name: NF15324_low_19
Description: NF15324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15324_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 1 - 406
Target Start/End: Complemental strand, 28668335 - 28667929
Alignment:
| Q |
1 |
cgcagggggatgttccatattatcttgttggacatgtaacactggttctaagatggctatgcttgcgacatcagagttatgagcaatttcatcataaa-c |
99 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| | |
|
|
| T |
28668335 |
cgcagggggatgttccacattatcttgttgaacatgtaatactggttctaagatggctatgcttgcgacatcagagttatgagcaatttcatcagaaaac |
28668236 |
T |
 |
| Q |
100 |
attttcgagtgcgaaatgaaaagagttgttaccgccatcaagaggtgtttctgctgggtgctctacggtctggaaaaaatcagtttcaacgagagcaata |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
28668235 |
attttcgagtgcgaaatgaaaagagttgttaccgccatcaagaggtgtttctgttgggtgctctacggtctagaaaaaatcagtttcaacgggagcaata |
28668136 |
T |
 |
| Q |
200 |
atataaggtgaagcttgctgttcaggatgctctattctcgtatcagacaccgcaatttcaaaagcaacaactggttttggaaaatccaaagatgacccaa |
299 |
Q |
| |
|
||| ||||||||||||| |||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
28668135 |
atagaaggtgaagcttgttgttcaggatgctctattgtcgtatcagacactgcaatttcaaaagcaacaactggttttgaaaaagccaaagatgacccaa |
28668036 |
T |
 |
| Q |
300 |
ctccgagaggattttcacgttcccaccaaattttggtttgagccttctgctgtatgatggcatatttgcctttgccctgcacctttttaatgttattatt |
399 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28668035 |
ctccgagaggattttcacgttcccaccaaattttggtttgcgccttctgttgtatgatggcatgtttccctttgccctgcacctttttaatgttattatt |
28667936 |
T |
 |
| Q |
400 |
atctctg |
406 |
Q |
| |
|
||||||| |
|
|
| T |
28667935 |
atctctg |
28667929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 17257540 - 17257484
Alignment:
| Q |
1 |
cgcagggggatgttccatattatcttgttggacatgtaacactggttctaagatggc |
57 |
Q |
| |
|
|||| ||||| |||||| |||||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
17257540 |
cgcaaggggaggttccacattatcttattgaacatgtaacaccggttctaagatggc |
17257484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University