View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15324_low_21 (Length: 411)
Name: NF15324_low_21
Description: NF15324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15324_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 7 - 238
Target Start/End: Complemental strand, 44201676 - 44201446
Alignment:
| Q |
7 |
atacgttggatactttagaatcacatatatttgagtaagtcaaacatcannnnnnnnnatttaataaattagttatatttgcctgttcaaggggtacaaa |
106 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
44201676 |
atacgttgaatactttagaatcacatatatttgagtaagtcaaacatcattttttttt-tttaataaattagttatatttggcttttcaaggggtacaaa |
44201578 |
T |
|
| Q |
107 |
ttaaagggcttaattagtacgagtcatcccaactagtttggttaccaacactaacaagtttttgcagcactaaggagtatgaactatgaagggcattaca |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44201577 |
ttaaagggcttaattagtacgagtcatcccaactagtttggttaccaacactaacaagtttttgcagcactaaggagtatgaactatgaagggcattaca |
44201478 |
T |
|
| Q |
207 |
agaaaatcacaatcaaaagtgtcaaatgcctt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
44201477 |
agaaaatcacaatcaaaagtgtcaaatgcctt |
44201446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 287 - 403
Target Start/End: Complemental strand, 44201432 - 44201327
Alignment:
| Q |
287 |
gtatgtagtcgtcaattttatcttccaaaatttagaccaaaacaattcaaaacttaatcgataaaaagcatttttctactgaatgtatttaaacgtaaat |
386 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44201432 |
gtatgtagtcgtcaatcttatcttccaaaatttagaccaaaacaattcaaaacttaatcgataaaaag-----------tgaatgtatttaaacgtaaat |
44201344 |
T |
|
| Q |
387 |
cagtttagattcatctc |
403 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
44201343 |
cagtttagattcatctc |
44201327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University