View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15324_low_34 (Length: 332)
Name: NF15324_low_34
Description: NF15324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15324_low_34 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 124 - 332
Target Start/End: Original strand, 6157814 - 6158020
Alignment:
| Q |
124 |
gatttacttgaatttgaaaaccattatttatcggtacctgatgtgtttgttcctccattctttttccaacaacaaacaaagccagaaaaacaactcatat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6157814 |
gatttacttgaatttgaaaaccattatttatcggtacctgatgtgtttgttcctccattctttttccaacaataaacaaagccagaaaaacaactcatat |
6157913 |
T |
 |
| Q |
224 |
ctcctacaatcacaaccaactacacagagagaagatgagagtgaacacacaannnnnnnnnctctttgtctcgagaattgtagtgnnnnnnntattatca |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
6157914 |
ctcctacaatcacaaccaactacacagagagaagatgagagtgaacacacaa--tttttttctctttgtctcgagaattgtagtgaaaaaaatattatca |
6158011 |
T |
 |
| Q |
324 |
ctacaccga |
332 |
Q |
| |
|
||||||||| |
|
|
| T |
6158012 |
ctacaccga |
6158020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University