View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15324_low_40 (Length: 306)
Name: NF15324_low_40
Description: NF15324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15324_low_40 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 28 - 261
Target Start/End: Complemental strand, 9658250 - 9658017
Alignment:
| Q |
28 |
caccatcttagatgtatatgtgtnnnnnnncttttatgtcgacaatgtttgtacaatgtattatccatgattgtgcctcaaattcggttaacatatattc |
127 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9658250 |
caccatcttagatgtatatgtgtaaaaaaacttttatgtcgacaatgtttgtacaatgtattatccatgattgtgcctcaaattcggttaacatatattc |
9658151 |
T |
 |
| Q |
128 |
tgtcagctcagttgtttgtacaattcagacgaggtattttagaaagcatgcattgatacgcatatataaaggttgaaactactccattcattacaaacaa |
227 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
9658150 |
tgtcagctcagttgtttgtacaatccagacgaggtattttagaaagcatgcattgatacgcatacataaaggttgaaactactccattcattacaaacaa |
9658051 |
T |
 |
| Q |
228 |
atttggatcatgcatgcagttactcataaaggag |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
9658050 |
atttggatcatgcatgcagttactcataaaggag |
9658017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University