View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15324_low_45 (Length: 293)
Name: NF15324_low_45
Description: NF15324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15324_low_45 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 17 - 284
Target Start/End: Complemental strand, 26225448 - 26225180
Alignment:
| Q |
17 |
aaatttggaatgctactttcacttatcttgtagtcttcaagctaat-tttgacaaaaaatatgtttgatacaacttgcagttaaggtgtattttgcttct |
115 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26225448 |
aaatttggaatgctactttcgcttatcttgtagtcttcaagctaatatttgacaaaaaatatgtttgatacaacttgcagttaaggtgtattttgcttct |
26225349 |
T |
 |
| Q |
116 |
gttattcacagtgcaattgtttgctatcttttgcttgcctaagagataaggttttcatcaatgaactggcaacttccattggtgctttttctttctattt |
215 |
Q |
| |
|
||| || ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
26225348 |
gttgttgacaatgcaattgtttgctatcttttgcttgcctaagagataaggttttcatcaatgaactgtcaacttccattggtactttttctttctattt |
26225249 |
T |
 |
| Q |
216 |
tatctctaacgtaatcagtatctcataatccaattagcttactaatactagcactctttaaagaataat |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26225248 |
tatctctaacgtaatcagtatctcataatccaattagcttactaatactagcactctttaaagaataat |
26225180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University