View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15324_low_47 (Length: 284)
Name: NF15324_low_47
Description: NF15324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15324_low_47 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 24 - 144
Target Start/End: Original strand, 3430606 - 3430726
Alignment:
| Q |
24 |
ttcttatgtaagaataacgatgttatagaaccaagtatgaaaggaataacaaatattttttaatacatagataatgatgnnnnnnnatataggatgtcct |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3430606 |
ttcttatgtaagaataacgatgttatagaaccaagtatgaaaggaataacaaatattttttaatacatagataatgatgtttttttatataggatgtcct |
3430705 |
T |
|
| Q |
124 |
tatgcggattacaacatacac |
144 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
3430706 |
tatgcggattacaacatacac |
3430726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 206 - 275
Target Start/End: Original strand, 3430791 - 3430862
Alignment:
| Q |
206 |
tgacgtttttacaatttaaaactctaattctgactttattggtagtaaaaacacttct--tactagtataat |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3430791 |
tgacgtttttacaatttaaaactctaattctgactttattggtagtaaaaacacttcttatactagtataat |
3430862 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University