View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15324_low_57 (Length: 252)
Name: NF15324_low_57
Description: NF15324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15324_low_57 |
 |  |
|
| [»] chr2 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 72; Significance: 7e-33; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 177 - 252
Target Start/End: Original strand, 7262122 - 7262197
Alignment:
| Q |
177 |
caagagtgatttgtttgataaataaaaccaatgatgatggaggtgaaatgcacataggtgataagtcataactcat |
252 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7262122 |
caagagtgatttgtttgataaataaaatcaatgatgatggaggtgaaatgcacataggtgataagtcataactcat |
7262197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 7262051 - 7262099
Alignment:
| Q |
1 |
taaacattaaaactcacacacacaatgacgcaaatagagtggctgaggttc |
51 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
7262051 |
taaacattaaaactcacacgca--atgacgcaaatagagtggctgaggttc |
7262099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 47 - 117
Target Start/End: Complemental strand, 23957122 - 23957052
Alignment:
| Q |
47 |
ggttcgaacctcgatcacgacatccggtctagtaatttcaacattttactggttgagctagaacttatgga |
117 |
Q |
| |
|
|||||||||| |||||| ||||||||| ||| |||||| ||||||| | ||||||||||||||| |||| |
|
|
| T |
23957122 |
ggttcgaaccccgatcatgacatccggcctaacaatttcgacattttgccagttgagctagaacttctgga |
23957052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 47 - 117
Target Start/End: Original strand, 18462014 - 18462084
Alignment:
| Q |
47 |
ggttcgaacctcgatcacgacatccggtctagtaatttcaacattttactggttgagctagaacttatgga |
117 |
Q |
| |
|
|||||||||| ||||| ||||||||||||| ||||||| ||||||||| ||||||| ||||||| |||| |
|
|
| T |
18462014 |
ggttcgaaccccgatcttgacatccggtctaataatttcgacattttaccagttgagccagaacttctgga |
18462084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 45 - 114
Target Start/End: Original strand, 42645521 - 42645590
Alignment:
| Q |
45 |
gaggttcgaacctcgatcacgacatccggtctagtaatttcaacattttactggttgagctagaacttat |
114 |
Q |
| |
|
|||||||||||| |||||| |||||||| |||| |||||| | |||||||| |||||||||| |||||| |
|
|
| T |
42645521 |
gaggttcgaaccccgatcatgacatccgatctaataattttagcattttaccagttgagctaggacttat |
42645590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 49 - 117
Target Start/End: Complemental strand, 40503665 - 40503597
Alignment:
| Q |
49 |
ttcgaacctcgatcacgacatccggtctagtaatttcaacattttactggttgagctagaacttatgga |
117 |
Q |
| |
|
||||||||| ||||| ||||||||| ||| |||||||||||||| ||||||||||||||| |||| |
|
|
| T |
40503665 |
ttcgaaccttgatcatgacatccggcctaacaatttcaacattttgtcagttgagctagaacttctgga |
40503597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University