View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15324_low_62 (Length: 235)
Name: NF15324_low_62
Description: NF15324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15324_low_62 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 13 - 219
Target Start/End: Complemental strand, 32829438 - 32829230
Alignment:
| Q |
13 |
gagatgtcgagaagagaatttcttctttgtggcacacatttttccaaggcttttcagttttggtgaaataggcacgaacattagagaagtttcatcatgt |
112 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32829438 |
gagatgtcgagaagagaatgtattctttgtggcacgcatttttccaaggcttttcagttttggtgaaataggcacgaacattagagaagtttcatcatgt |
32829339 |
T |
|
| Q |
113 |
gaaagtgattgaacagattctggcgccaatctactaggt--tgcttgatcatttaagtgcttctttggacactttaggagaagaaaatactgcctatggc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32829338 |
gaaagtgattgaacagattctggcgccaatctactaggtaaagcttgatcatttaagtgcttctttggacactttaggagatgaaaatactgcctatggc |
32829239 |
T |
|
| Q |
211 |
gctcctaag |
219 |
Q |
| |
|
|||||||| |
|
|
| T |
32829238 |
actcctaag |
32829230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University