View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15324_low_65 (Length: 221)

Name: NF15324_low_65
Description: NF15324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15324_low_65
NF15324_low_65
[»] chr5 (1 HSPs)
chr5 (15-203)||(569550-569733)


Alignment Details
Target: chr5 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 15 - 203
Target Start/End: Original strand, 569550 - 569733
Alignment:
15 gatgaagaagctcttgatggtatatatatactttcctaattaaaacatagacattatatataatcaaaaccatgcacaaatatttaaacagttcatgttc 114  Q
    ||||||||||||||||||||||||||  | |||     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
569550 gatgaagaagctcttgatggtatatacttgctt-----attaaaacatagacattatatataatcaaaaccatgcacaaatatttaaacagttcatgtgc 569644  T
115 tatgactttgcagcgtacgagagattatgcaaattggagggtatatttccatctctggaggcagcacatgcattggctatattagataa 203  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
569645 tatgactttgcagcgtacgagagattatgcaaattggagggtatatttccatctctggaggcagcacatgcattggctatattagataa 569733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University