View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15324_low_65 (Length: 221)
Name: NF15324_low_65
Description: NF15324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15324_low_65 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 15 - 203
Target Start/End: Original strand, 569550 - 569733
Alignment:
| Q |
15 |
gatgaagaagctcttgatggtatatatatactttcctaattaaaacatagacattatatataatcaaaaccatgcacaaatatttaaacagttcatgttc |
114 |
Q |
| |
|
|||||||||||||||||||||||||| | ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
569550 |
gatgaagaagctcttgatggtatatacttgctt-----attaaaacatagacattatatataatcaaaaccatgcacaaatatttaaacagttcatgtgc |
569644 |
T |
|
| Q |
115 |
tatgactttgcagcgtacgagagattatgcaaattggagggtatatttccatctctggaggcagcacatgcattggctatattagataa |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
569645 |
tatgactttgcagcgtacgagagattatgcaaattggagggtatatttccatctctggaggcagcacatgcattggctatattagataa |
569733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University