View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15324_low_67 (Length: 212)
Name: NF15324_low_67
Description: NF15324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15324_low_67 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 19 - 188
Target Start/End: Original strand, 34231913 - 34232082
Alignment:
| Q |
19 |
ggtaaaaggcacgtccccattcattatgcttttgtccctaaaaatattcttcacagaatctatggtcattatcttatctcaacatcattgcattattgta |
118 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34231913 |
ggtaaaagacacgtccccattcattattcttttgtccctaaaaatattcttcatagaatctatggtcattatcttatctcaacatcattgcattactgta |
34232012 |
T |
|
| Q |
119 |
aagtaagactttcatatgatgagtgtacaccgaagatatatgcagatctcaaacttaggtgctattttat |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34232013 |
aagtaagactttcatatgatgagtgtacaccgaagatatatgcagatctcaaacttaggtgctattttat |
34232082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 183 - 212
Target Start/End: Original strand, 39440478 - 39440507
Alignment:
| Q |
183 |
ttttatgagaaatgatatttgaacaaccat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39440478 |
ttttatgagaaatgatatttgaacaaccat |
39440507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University