View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15324_low_71 (Length: 204)
Name: NF15324_low_71
Description: NF15324
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15324_low_71 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 7e-85; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 16 - 186
Target Start/End: Complemental strand, 38374503 - 38374333
Alignment:
| Q |
16 |
aatatgagttgagaccaaaactgcaaaaaatgtgatacttgaggaccaaaaagtttgattttaaaagatgataaatatgttttcgtttctatgataaaat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38374503 |
aatatgagttgagaccaaaactgcaaaaaatgtgatacttgaggaccaaaaagtttgattttaaaagatgataaatatgttttcgtttctatgataaaat |
38374404 |
T |
 |
| Q |
116 |
aggaggcaaagaatttcaattaagtctatgttatatattaccggtttgtatcgacccctctcataatatgt |
186 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38374403 |
aggaggtaaagaatttcaattaagcctatgttatatattaccggtttgtatcgatccctctcataatatgt |
38374333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 28 - 81
Target Start/End: Original strand, 35053196 - 35053249
Alignment:
| Q |
28 |
gaccaaaactgcaaaaaatgtgatacttgaggaccaaaaagtttgattttaaaa |
81 |
Q |
| |
|
|||||||| |||||||||||||| | | ||||||||||||||| ||||||||| |
|
|
| T |
35053196 |
gaccaaaattgcaaaaaatgtgaaattagaggaccaaaaagttcaattttaaaa |
35053249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University