View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15326_high_13 (Length: 238)
Name: NF15326_high_13
Description: NF15326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15326_high_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 50392994 - 50393213
Alignment:
| Q |
1 |
ctcttaattagtggaggataatgcgcatcattgataagtgattagagggtcgagggatataaccattatttctcttttctctatgaaacnnnnnnnnctt |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
50392994 |
ctcttaattaatggaggataatgcgcatcattgataagtgattagagggtcgagggatataaccattatttctcttttctctatgaaacttttttttctt |
50393093 |
T |
 |
| Q |
101 |
taaaataaactgggtaacatatcattttttactgaagctnnnnnnnntatgaaagaaaaagactatctcgatcgcaagaggaaattttttaaccccaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
50393094 |
taaaataaactgggtaacatatcattttttactggagctaaaaaaaatatgaaagaaaaagactatctcgatcgaaagaggaaaatttttaaccccaaat |
50393193 |
T |
 |
| Q |
201 |
cactgcatagtgagcatatg |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
50393194 |
cactgcatagtgagcatatg |
50393213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University