View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15326_high_8 (Length: 330)
Name: NF15326_high_8
Description: NF15326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15326_high_8 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 305; Significance: 1e-172; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 305; E-Value: 1e-172
Query Start/End: Original strand, 22 - 330
Target Start/End: Complemental strand, 54473329 - 54473021
Alignment:
| Q |
22 |
accgctatttccttaccattagggagaatacctttatgtacatatccaaacccaccttgacccaacaagttttgttttgaaaacccaccggtggcagttg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54473329 |
accgctatttccttaccattagggagaatacctttatgtacatatccaaacccaccttgacccaacaagttttgttttgaaaacccaccggtggcagttg |
54473230 |
T |
|
| Q |
122 |
ataactcttcataactgaatgagctctggttgaacccaagtgcaaccgttgggtgtggtggtggcaatacaggatctactgggccagagtaactggagtt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54473229 |
ataactcttcataactgaatgagctctggttgaacccaagtgcaaccgttgggtgtggtggtggcaatacaggatctactgggccagagtaactggagtt |
54473130 |
T |
|
| Q |
222 |
ggtcaactcactgctactaacctggtgcggaggtgtcttttttgaaggtgtcatttttggaggtgtcttttttggaggtgttggagtccaaccaccacct |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
54473129 |
ggtcaactcactgctactaacctggtgcggaggtgtcttttttgaaggtgtcatttttggaggtgttttttttggaggtgttggagtccaaccaccacct |
54473030 |
T |
|
| Q |
322 |
tgagctggt |
330 |
Q |
| |
|
||||||||| |
|
|
| T |
54473029 |
tgagctggt |
54473021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 34 - 83
Target Start/End: Complemental strand, 32902757 - 32902708
Alignment:
| Q |
34 |
ttaccattagggagaatacctttatgtacatatccaaacccaccttgacc |
83 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||| ||||||||||| |
|
|
| T |
32902757 |
ttaccattagggagaatacctctatgcacatatccaaatccaccttgacc |
32902708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University