View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15326_low_11 (Length: 271)
Name: NF15326_low_11
Description: NF15326
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15326_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 17 - 130
Target Start/End: Original strand, 41752364 - 41752477
Alignment:
| Q |
17 |
atatcacaccaatttattaccaagattcttcctataaatactatcccaccaaaaacttctctgttttaatcctcccctacttctactcttctctctttct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
41752364 |
atatcacaccaatttattaccaagattcttcctataaatactatcccaccaaaaacttctctgttttaatcctcccctacttctactcttctctcttttt |
41752463 |
T |
|
| Q |
117 |
taatttctcccacc |
130 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
41752464 |
taatttctcccacc |
41752477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 177 - 271
Target Start/End: Original strand, 41752532 - 41752626
Alignment:
| Q |
177 |
tttagaatcatattcatcttcatccgtgaaactcttattgtttatggttccactcataatagttgctggtctagtttctgtgttgggtcctaatc |
271 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41752532 |
tttagaatcatattcatcttcatccatgaaactcttattgtttatggttccactcataatagttgctggtctagtttccgtgttgggtcctaatc |
41752626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University