View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15329_high_11 (Length: 236)
Name: NF15329_high_11
Description: NF15329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15329_high_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 30133432 - 30133652
Alignment:
| Q |
1 |
ttacctgagcttgaaagaacaattcagctctttttgtttcctgagcttgagcatgcaatgcagctctatatcttgcctcggctcgagcgagcgatccagc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| || |
|
|
| T |
30133432 |
ttacctgagcttgaaagaacaattcagctctttttgtttcctgagcttgagcatgcaatgcagctctgtatcttgcctcggctcgagcgagcgatcccgc |
30133531 |
T |
 |
| Q |
101 |
tgtatattatcaggagagatgccgagtagcgatagtctgtaagcatagaattacaattaatgactttctctattttaccaggttataatcatccattcct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30133532 |
tgtatattatcaggagagatgccgagtagcgatagtctgtaagcatagaattacaattaatgacttgctctattttaccaggttataatcatccattcct |
30133631 |
T |
 |
| Q |
201 |
accaagtttttagttatcttt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
30133632 |
accaagtttttagttatcttt |
30133652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 29939360 - 29939443
Alignment:
| Q |
1 |
ttacctgagcttgaaagaacaattcagctctttttgtttcctgagcttgagcatgcaatgcagctctatatcttgcctcggctc |
84 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||| |||||| ||||||| |||||| ||||||||||| |||||||||||| |
|
|
| T |
29939360 |
ttacctgagcttgaaataacatttcagctctttttttttcctcagcttgacattgcaatacagctctatattttgcctcggctc |
29939443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 172 - 217
Target Start/End: Original strand, 604755 - 604800
Alignment:
| Q |
172 |
attttaccaggttataatcatccattcctaccaagtttttagttat |
217 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||| |||||| |
|
|
| T |
604755 |
attttaccaggttataatcatccaatcctaccgagttttcagttat |
604800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University