View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15329_low_15 (Length: 221)

Name: NF15329_low_15
Description: NF15329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15329_low_15
NF15329_low_15
[»] chr1 (2 HSPs)
chr1 (84-221)||(4859824-4859960)
chr1 (1-34)||(4859741-4859774)


Alignment Details
Target: chr1 (Bit Score: 102; Significance: 8e-51; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 84 - 221
Target Start/End: Original strand, 4859824 - 4859960
Alignment:
84 gtgaaacaacttggtacgttatttctgctctttattaatcttttatctgtgccttctggttttagtaccttatcacaaatgtccccatagaagatagatt 183  Q
    |||| ||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| |||||||||||||  ||    
4859824 gtgagacaacttggtacgttatttctgctctttattaatcttttatttgtaccttctggttttagtaccttatcacaaatgt-cccatagaagataagtt 4859922  T
184 aaaaaattatatttaaatgttttatattcttcgacatc 221  Q
    |||||||||||||||||||||||||||| ||| |||||    
4859923 aaaaaattatatttaaatgttttatattattcaacatc 4859960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 4859741 - 4859774
Alignment:
1 tagattcttactcttttggcttatcaaggtaata 34  Q
    ||||||||||||||||||||||||||||||||||    
4859741 tagattcttactcttttggcttatcaaggtaata 4859774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University