View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15329_low_15 (Length: 221)
Name: NF15329_low_15
Description: NF15329
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15329_low_15 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 8e-51; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 84 - 221
Target Start/End: Original strand, 4859824 - 4859960
Alignment:
| Q |
84 |
gtgaaacaacttggtacgttatttctgctctttattaatcttttatctgtgccttctggttttagtaccttatcacaaatgtccccatagaagatagatt |
183 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||| ||||||||||||| || |
|
|
| T |
4859824 |
gtgagacaacttggtacgttatttctgctctttattaatcttttatttgtaccttctggttttagtaccttatcacaaatgt-cccatagaagataagtt |
4859922 |
T |
 |
| Q |
184 |
aaaaaattatatttaaatgttttatattcttcgacatc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
4859923 |
aaaaaattatatttaaatgttttatattattcaacatc |
4859960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 4859741 - 4859774
Alignment:
| Q |
1 |
tagattcttactcttttggcttatcaaggtaata |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
4859741 |
tagattcttactcttttggcttatcaaggtaata |
4859774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University