View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1532_high_18 (Length: 453)
Name: NF1532_high_18
Description: NF1532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1532_high_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 395; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 395; E-Value: 0
Query Start/End: Original strand, 7 - 425
Target Start/End: Original strand, 10760108 - 10760526
Alignment:
| Q |
7 |
gtgagatgaagcaacccaaagaacattactattacatttttcttctcgttttgggtttctctcatgaaagatcatagaaaacatagcagagccatttcat |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10760108 |
gtgacatgaagcaacccaaagaacattactattacatttttcttctcgttttgggtttctctcatgaaagatcatagaaaacatagcagagccatttcat |
10760207 |
T |
|
| Q |
107 |
ggagcacattcttctggttcactattgtggttgtcttatcttccattatctttacctccctaattatttcatccatccaccccttctacctccctcgatt |
206 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10760208 |
ggagcacattcttttggttcactattgtggttgtcttatcttccattatctttacctccctaattatttcatccatccaccccttctacctccctcgatt |
10760307 |
T |
|
| Q |
207 |
tcacatcccaattgcagctttgaaatggccaactccagtgccaccccaaatcacaattcgggaaacagttatgcttcctgatcatgttttaatgttctta |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
10760308 |
tcacatcccaattgcagctttgaaatggccaactccagtgccaccccaaatcacaattcgggaaacagttttgcttcctgatcatgttttaattttctta |
10760407 |
T |
|
| Q |
307 |
aactaccctttatcttttcgctatcacaccaaacatgaccttcaatgtgtttactcttcagatgatgactcaaaacctcgtctcactcaagaaccggttc |
406 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10760408 |
aactaccctttatcttttcgctatcacaccaaacgtgaccttcaatgtgtttactcttcagatcatgactcaaaacctcgtctcactcaagaaccggttc |
10760507 |
T |
|
| Q |
407 |
aactttactcgattaggct |
425 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
10760508 |
aactttactcgattaggct |
10760526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University