View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1532_high_56 (Length: 300)
Name: NF1532_high_56
Description: NF1532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1532_high_56 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 8e-64; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 8e-64
Query Start/End: Original strand, 132 - 271
Target Start/End: Original strand, 2272170 - 2272309
Alignment:
| Q |
132 |
ttattcaaaccaaccatgagaattttttcatcccttgatcgaatgataaaaatgttaagaatgctatagtgagttgtaggaaaacaaaccaagccgatac |
231 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
2272170 |
ttattcaaaccaaccatgagaatgttttcatcccttgatccaatgataaaaatgttaagaatgttatagtgagttgtaggaaaacaaaccaagccgatac |
2272269 |
T |
|
| Q |
232 |
tattaatgcccaaattaaacgtggtatctattgcttgttg |
271 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2272270 |
tattaatgcccaaattaaacgtggtatctcttgcttgttg |
2272309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 6 - 65
Target Start/End: Original strand, 2272046 - 2272105
Alignment:
| Q |
6 |
aggagcagagagagtagaatataatctccatacagatatcaattattacgaagacataac |
65 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2272046 |
aggaacagagagagtagaatataatctccatacagatatcaattattacgaaggcataac |
2272105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University