View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1532_high_8 (Length: 530)
Name: NF1532_high_8
Description: NF1532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1532_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-106; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 240 - 464
Target Start/End: Complemental strand, 12343274 - 12343051
Alignment:
| Q |
240 |
ttatatactacttttcttctctgttttctttggaattaaaaaaggtaaagtagaatatttcctataaattagctttaacgtgtgcattgtgacattgtcc |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12343274 |
ttatatactacttttcttctctgttttctttggaattaaaaaaggtaaagtagaatatttcctataaattagctttaacgtgtgcattgtgacattgtcc |
12343175 |
T |
 |
| Q |
340 |
ctatgcacaaatctaacttttctaacacacacacgtacagagaatacccttgtcacaatgagacctaactagggctttgttttttacacacaaagnnnnn |
439 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12343174 |
ctatgcacaaatctaacttttctaacacacacacgtacagagaatacccttgtcacaatgagacctaactagggctttgttttttacacacaaag-aaaa |
12343076 |
T |
 |
| Q |
440 |
nnntactttaaaaagaaatgttgaa |
464 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
12343075 |
aaatactttaaaaagaaatgttgaa |
12343051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 18 - 82
Target Start/End: Complemental strand, 12343514 - 12343450
Alignment:
| Q |
18 |
tggctgtttcttttgtgtgaagtatatgtgagaaaatgacacttgagggactataagagagagag |
82 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12343514 |
tggctgtttcttttgtgtgaagtatatgtgagaaaatgacacttgagggactataagagagagag |
12343450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 80 - 120
Target Start/End: Complemental strand, 12343434 - 12343394
Alignment:
| Q |
80 |
gagggttgtttcttttgtggatgtggggggtagggtactat |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12343434 |
gagggttgtttcttttgtggatgtggggggtagggtactat |
12343394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 482 - 516
Target Start/End: Complemental strand, 12343033 - 12342999
Alignment:
| Q |
482 |
acggtcacatgatctatggaacacaaattgcaaca |
516 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12343033 |
acggtcacatgatctatggaacacaaatttcaaca |
12342999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University