View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1532_low_102 (Length: 267)
Name: NF1532_low_102
Description: NF1532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1532_low_102 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 164 - 257
Target Start/End: Complemental strand, 8649917 - 8649824
Alignment:
| Q |
164 |
agttgtttgttgttttactagctttcatagttttttcagccagatctagtattttcaattcaatttgttgtttggcttcatctttatccctttg |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
8649917 |
agttgtttgttgttttactagctttcatagtttcttcttccagatctagtattttcaattcaatctgttgtttggcttcatctttatccctttg |
8649824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 46 - 169
Target Start/End: Complemental strand, 8668388 - 8668267
Alignment:
| Q |
46 |
atacctccctccaccgaaatctctcctcctcattttgtattgggccatctaaaagccagatctgttacatcagaacctccccttctgtcannnnnnntat |
145 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| | || ||||||||||||||| ||||| ||||||||||||||||||||||||| ||| |
|
|
| T |
8668388 |
atacctccctccaccggaatctctcctcctcatttcttttttggccatctaaaagccgaatctggtacatcagaacctccccttctgtca--ccccctat |
8668291 |
T |
|
| Q |
146 |
tttaaatattgtggttttagttgt |
169 |
Q |
| |
|
|||||| ||||||||||||||||| |
|
|
| T |
8668290 |
tttaaagattgtggttttagttgt |
8668267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University