View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1532_low_103 (Length: 266)
Name: NF1532_low_103
Description: NF1532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1532_low_103 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 31 - 266
Target Start/End: Original strand, 6816822 - 6817057
Alignment:
| Q |
31 |
tgaatattatactccatgttattttgtggttgagcaacaatacaaataatacctcaaactaagaccagttcggtaatcgagtttaggaaggaaaccgaac |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6816822 |
tgaatattatactccatgttattttgtggttgagcaacaatacaaataatacctcaaactaagaccagttcggtaatcgagtttaggaaggaaaccgaac |
6816921 |
T |
|
| Q |
131 |
caatttcaactgttataacagttcggtaaaattaaaccgaattgtaaatggttcgcccaaaatcgaacagaggctaactggtctggcataaaggtttggt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6816922 |
caatttcaactgttataacagttcggtaaaattaaaccgaattgtaaatggttcgcccgaaatcgaacagaggctaactggtctggcataaaggtttggt |
6817021 |
T |
|
| Q |
231 |
tcaacggtactgtggtttcaaaccaaacttgattct |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
6817022 |
tcaacggtactgtggtttcaaaccaaacttgattct |
6817057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University