View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1532_low_47 (Length: 405)
Name: NF1532_low_47
Description: NF1532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1532_low_47 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 66; Significance: 5e-29; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 42 - 177
Target Start/End: Original strand, 2928454 - 2928593
Alignment:
| Q |
42 |
tggtgattctagtatgattccagag-ctgtttcaac---tagtctgtcaatctctggtgtactgtttcgatagtttttcagtttcttagatttgtgtatt |
137 |
Q |
| |
|
||||||||| ||||||||| ||| | |||||||||| |||||||||||||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
2928454 |
tggtgattcaagtatgattgcaggggctgtttcaacaactagtctgtcaatctctggtgtactgtttgggcggtttttcagtttcttagatttgtgtatt |
2928553 |
T |
|
| Q |
138 |
ggagctgttctattgcgtttttcatagtataagttagttg |
177 |
Q |
| |
|
|||| ||||||||| ||||||| |||||| ||| ||||| |
|
|
| T |
2928554 |
ggagttgttctattttgtttttcttagtatcagtcagttg |
2928593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 119 - 175
Target Start/End: Complemental strand, 3002773 - 3002717
Alignment:
| Q |
119 |
tttcttagatttgtgtattggagctgttctattgcgtttttcatagtataagttagt |
175 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
3002773 |
tttcttatatttgtgtattggagctgttctattgcgtttttcttagtatcagttagt |
3002717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 112 - 152
Target Start/End: Complemental strand, 37200292 - 37200252
Alignment:
| Q |
112 |
ttttcagtttcttagatttgtgtattggagctgttctattg |
152 |
Q |
| |
|
||||||||||||||| |||||||||||| |||| ||||||| |
|
|
| T |
37200292 |
ttttcagtttcttagttttgtgtattggggctgctctattg |
37200252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University