View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1532_low_50 (Length: 405)
Name: NF1532_low_50
Description: NF1532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1532_low_50 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 3e-95; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 3e-95
Query Start/End: Original strand, 208 - 392
Target Start/End: Original strand, 52698418 - 52698602
Alignment:
| Q |
208 |
gctaagtgcaaatattgatgtgtttattattttgtgaattatgtcacagggaatgattatgctaacaatttcggcctcctttgccacattgcacccgcca |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52698418 |
gctaagtgcaaatattgatgtgtttattattttgtgaattatgtcacagggaatgattatgctaacaatttcggcctccttttccacattgcacccgcca |
52698517 |
T |
 |
| Q |
308 |
aaatgcgctgtgaaagtgacaccgtgcaaagaagcaagccaaggccaaaacttattcttgtatagtgcacttggcctcattgcct |
392 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52698518 |
aaatgtgctgtgaaagtgacaccgtgcaaagaagcaagccaaggccaaaacttattcttgtatagtgcacttggcctcattgcct |
52698602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 30 - 140
Target Start/End: Original strand, 52698206 - 52698316
Alignment:
| Q |
30 |
gcttaccttggtcgatttagaaccatcattgttttctctaccatctatgctgtggtaaatcctatattttaccaactaatcataacaaacttgtaatttg |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
52698206 |
gcttaccttggtcgatttagaaccatcattgttttctctaccatctatgctgtggtaaatcctatattttaccaactaatcataacaaacttgtaatctg |
52698305 |
T |
 |
| Q |
130 |
taacaacttta |
140 |
Q |
| |
|
||||||||||| |
|
|
| T |
52698306 |
taacaacttta |
52698316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 214 - 285
Target Start/End: Original strand, 52721072 - 52721141
Alignment:
| Q |
214 |
tgcaaatattgatgtgtttattattttgtgaattatgtcacagggaatgattatgctaacaatttcggcctc |
285 |
Q |
| |
|
||||||||||||||| | ||| ||||||||||| |||||||||| ||| || |||| ||||| |||||||| |
|
|
| T |
52721072 |
tgcaaatattgatgtct--atttttttgtgaattttgtcacaggggatggttttgctgacaatgtcggcctc |
52721141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University