View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1532_low_57 (Length: 382)
Name: NF1532_low_57
Description: NF1532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1532_low_57 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 32338283 - 32338482
Alignment:
| Q |
1 |
acgacaaacaacacaataaatttatgtgcgacgagaacaatggctcgcacaagagagaacgattgcataagattggagag-ttttttatatcgaaagcaa |
99 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
32338283 |
acgacaaacaacacaataaatttttgtgcggcgagaacaatagctcgcacaagagagaacgattgcataagattggagagtttttttttatcgaaagcaa |
32338382 |
T |
|
| Q |
100 |
acagtgagtctttgtacgttcatttgctttctatatgatagggtttagggtttctcatcaaagaagaaggaaattgtgcaaagaaaaagatagctgaaga |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32338383 |
acagtgagtctttgtacgttcatttgctttctatatgataggg--aagagtttctcatcaaagatgaaggaaattgtgcaaagaaaaagatagctgaaga |
32338480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 259 - 349
Target Start/End: Original strand, 32338543 - 32338633
Alignment:
| Q |
259 |
aacacaagttttttgtgtgaaagaagtaggttcaaacatgaaaaaattagcatgtgcaagttgtaaca-cccgtactaaatttatctagaat |
349 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || |||||||||||||||| |
|
|
| T |
32338543 |
aacacaagtttttt-tgtgaaagaagtaggttcaaacatgaaaaaattagcatgtgcaagttgtaacaccccatattaaatttatctagaat |
32338633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 317 - 349
Target Start/End: Original strand, 1454532 - 1454564
Alignment:
| Q |
317 |
agttgtaacacccgtactaaatttatctagaat |
349 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
1454532 |
agttgtaacacccatactaaatttatctagaat |
1454564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University