View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1532_low_58 (Length: 379)
Name: NF1532_low_58
Description: NF1532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1532_low_58 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 30 - 271
Target Start/End: Original strand, 8568129 - 8568370
Alignment:
| Q |
30 |
aaattgtgaatgaaaggaaatataaaatgattataaggaagacagtgataaaagtggagaaacctgtttttcttctcttattattattattgttatcatc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8568129 |
aaattgtgaatgaaaggaaatataaaatgattataaggaagacaatgataaaagtggagaaacctgtttttcttctcttattattattattgttatcatc |
8568228 |
T |
 |
| Q |
130 |
tttagaagcggtgtatgtcaaacgaatgtggaaagaagcatcctgttgatttgaattacatcgaacaccaaggagagtttgaagtggaggcagtagagaa |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
8568229 |
tttagaagcggtgtatgtcaaacgaatgtggaaagaagcatcctgttgatttgaattacatcgaccaccgaggagagtttgaagtggaggcagtagagaa |
8568328 |
T |
 |
| Q |
230 |
aagttgaaagcatctttagcagagatgaaagtagtattatct |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8568329 |
aagttgaaagcatctttagcagagatgaaagtagtattatct |
8568370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University