View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1532_low_64 (Length: 348)
Name: NF1532_low_64
Description: NF1532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1532_low_64 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 108 - 319
Target Start/End: Original strand, 47946399 - 47946609
Alignment:
| Q |
108 |
gaacaggaagaaggttgaatgtatgtgtgaaacattgctactgttggatccacgttggctcaacaaataattctttgttcaatgcttaagaattgttttg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
47946399 |
gaacaggaagaaggttgaatgtatgtgtgaaacattgctactgttggatccacgttggctcaacaaataattctttgttcaatgcttaataattgttttg |
47946498 |
T |
|
| Q |
208 |
tctagattattttcctttagatcaaaaggaacgtttatgatttaaaacaaatgtgtgatttactcagtacctcatatcatttatgatttatatgaatatg |
307 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47946499 |
tctagattatttt-ctttagatcaaaaggaacgtttatgatttaaaacaaatgtgtgatttactcagtacctcatatcatttatgatttatatgaatatg |
47946597 |
T |
|
| Q |
308 |
tttggtggtgcc |
319 |
Q |
| |
|
|||||||||||| |
|
|
| T |
47946598 |
tttggtggtgcc |
47946609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 108 - 319
Target Start/End: Original strand, 47951829 - 47952039
Alignment:
| Q |
108 |
gaacaggaagaaggttgaatgtatgtgtgaaacattgctactgttggatccacgttggctcaacaaataattctttgttcaatgcttaagaattgttttg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
47951829 |
gaacaggaagaaggttgaatgtatgtgtgaaacattgctactgttggatccacgttggctcaacaaataattctttgttcaatgcttaataattgttttg |
47951928 |
T |
|
| Q |
208 |
tctagattattttcctttagatcaaaaggaacgtttatgatttaaaacaaatgtgtgatttactcagtacctcatatcatttatgatttatatgaatatg |
307 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47951929 |
tctagattatttt-ctttagatcaaaaggaacgtttatgatttaaaacaaatgtgtgatttactcagtacctcatatcatttatgatttatatgaatatg |
47952027 |
T |
|
| Q |
308 |
tttggtggtgcc |
319 |
Q |
| |
|
|||||||||||| |
|
|
| T |
47952028 |
tttggtggtgcc |
47952039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University