View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1532_low_66 (Length: 343)
Name: NF1532_low_66
Description: NF1532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1532_low_66 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 9 - 314
Target Start/End: Original strand, 41088326 - 41088631
Alignment:
| Q |
9 |
atcataggagtggagattcgattgatctactgaaccagaacattcgaggcacgtgggagtttaacgttgctttcacgaaagatgccatcatacgtagtag |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41088326 |
atcataggagtggagattcgattgatctactgaaccagaacattcgaggcacgtgggagtttaacgttgctttcacgaaagatgccatcatacgtagtag |
41088425 |
T |
 |
| Q |
109 |
tattcatagttgaggatcagtgccttccacgtctcaaactccttccaattcatattttaactattgctcaataaaaataatatgttattgcaattcataa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41088426 |
tattcatagttgaggatcagtgccttccacgtctcaaactccttccaattcatattttaactattgctcaataaaaataatatgttattgcaattcataa |
41088525 |
T |
 |
| Q |
209 |
ttacttctaaccctaaccaaccatgcatttgtcttgaaatttgcatgtatcaaaaattcaaagggcgacctccatgcataaccgttgcaattaattaagg |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41088526 |
ttacttctaaccctaaccaaccatgcatttgtcttgaaatttgcatgtatcaaaaattcaaagggcgacctccatgcataaccgttgcaattaattaagg |
41088625 |
T |
 |
| Q |
309 |
tatatt |
314 |
Q |
| |
|
|||||| |
|
|
| T |
41088626 |
tatatt |
41088631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University