View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1532_low_75 (Length: 316)
Name: NF1532_low_75
Description: NF1532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1532_low_75 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 30 - 308
Target Start/End: Original strand, 43168911 - 43169189
Alignment:
| Q |
30 |
attcgagtatatgccggatggttcagaagttggtaaacacggtgaaacagatggatcccaaggatccttttcgagttgatatgactgataagcttttgga |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43168911 |
attcgagtatatgccggatggttcagaagttggtaaacacggtgaaacagatggatcccaaggatccttttcgagttgatatgactgataagcttttgga |
43169010 |
T |
 |
| Q |
130 |
aaaactgtaagttcactttttgaagttcaaagtttaaacatatttgatttcagtaattaatattggtttcataattatggttactgctatatgtcataat |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43169011 |
aaaactgtaagttcactttttgaagttcaaagtttaaacatatttgatttcagtaattaatattgttttcataattatggttactgctatatgtcataat |
43169110 |
T |
 |
| Q |
230 |
tattcacgttttccatctttcttttgacataatttattgtttagtgttgttccatgacacccccaaatctatctctgct |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43169111 |
tattcacgttttccatctttcttttgacataatttattgtttagtgttgttccatgacacccccaaatctatctgtgct |
43169189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University