View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1532_low_79 (Length: 309)
Name: NF1532_low_79
Description: NF1532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1532_low_79 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 16 - 280
Target Start/End: Complemental strand, 40311749 - 40311484
Alignment:
| Q |
16 |
gttgctgcaatatcttcattctttcacttattttctctcttctcacctgaaatccannnnnnnngcaacatttattaacaatgagacatgaactttgagg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40311749 |
gttgctgcaatatcttcattctttcacttattttctctcttctcacctgaaatccattttttttgcaacaattattaacaatgagacatgaactttgagg |
40311650 |
T |
|
| Q |
116 |
caattgaggaattccctttcagttgtaaattgtaataacctaagtagctccgacacttttgtccggctacacattaac-acatgttattacattcggcgt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
40311649 |
caattgaggaattccctttcagttgtaaattgtaataacctaagtagctccgacacttttgtccggctacacactaacggcatgttattacattcggcgt |
40311550 |
T |
|
| Q |
215 |
ttgtgtccctgttagggcttcataggtaaaaactgtattgcataccctttcagcaaggctgtggct |
280 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40311549 |
ttgtgtccgtgttagggcttcataggtaaaaactgtattgcataccctttcagcaaggctgtggct |
40311484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 16 - 66
Target Start/End: Complemental strand, 45176003 - 45175953
Alignment:
| Q |
16 |
gttgctgcaatatcttcattctttcacttattttctctcttctcacctgaa |
66 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
45176003 |
gttgctgcaacttcttcatcctttcacttattttctctcttcttacctgaa |
45175953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University