View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1532_low_86 (Length: 297)
Name: NF1532_low_86
Description: NF1532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1532_low_86 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 6e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 67 - 226
Target Start/End: Original strand, 8518606 - 8518763
Alignment:
| Q |
67 |
aaaattacttggttagagaacttcttaattatgacatatgggttatgccccattttcataatctatggttttataaggaattggaatatgaattatgaaa |
166 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8518606 |
aaaattactttgttagagaacttcttaattatgacatatgggttatgccccattttcagaatctatggttttataaggaattggaatatgaattatgaaa |
8518705 |
T |
 |
| Q |
167 |
cagaagctggctgagtacagaatatgatatttgcctcagaaagttattaagatgaagact |
226 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8518706 |
cagaagctggctgag--cagaatatgatatttgcctcagaaagttattaagatgaagact |
8518763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University