View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1532_low_93 (Length: 285)
Name: NF1532_low_93
Description: NF1532
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1532_low_93 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 30 - 273
Target Start/End: Complemental strand, 13580905 - 13580662
Alignment:
| Q |
30 |
ctgatgacacctctcaacacgaccattctgctgtggcatttcctcacggctagtttgataaacgatgcctttggaggcatgaaactgttttaaggaaaaa |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
13580905 |
ctgatgacacctctcaacacgaccattctgctgtggcatttcctcacggctagtttgataaacaatgcctttggaggcatgaaactgttttaaggaaaaa |
13580806 |
T |
 |
| Q |
130 |
cgcagggccattctcactgtgaatggccttgattcgcttggaaaattgtgtttcaaccaagttgtaaaagctactgatacaggaatgaatttcagatgta |
229 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||||||||| ||||| ||||||||||||||| ||| ||||||||| ||||||||||||||| |
|
|
| T |
13580805 |
cgcagggccattatcactgtgaatgggcttgattcgcttggaaaatcacgtttctaccaagttgtaaaagataccgatacaggactgaatttcagatgta |
13580706 |
T |
 |
| Q |
230 |
gcacgcattataacaacccaaatgaaacaagtaatagcaagtat |
273 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||| ||||| |
|
|
| T |
13580705 |
gcacgcattataaccacccaaatgaagcaagtaatagcgagtat |
13580662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University